Sequence ID | >WENV183746377 |
Genome ID | POVV01035620 |
Search identical group | |
Phylum/Class | [POVV] bioreactor metagenome; anaerobic chemostat enrichment culture, galacturonate as sole carbon source, pH 8; inoculated with |
Species | |
Start position on genome | 466 |
End posion on genome | 391 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
cggggttgtg |
tRNA gene sequence |
GCCGCTTTAGCTCAGTTGGTAGAGCACTCGCCTTGTAAGCGATAGGTCGTCTGTTCGAGT |
Downstream region at tRNA end position |
gggtctgccc |
Secondary structure (Cloverleaf model) | >WENV183746377 Thr TGT g ACCA gggtctgccc G - C C - G C - G G - C C - G T - A T - A T G T C A G A C A T G A A | | | | | G T C T C G G T C T G C G | | | | T T G G A G C T A A AGGTC C T T - A C - G G - C C - G C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |