| Sequence ID | >WENV183746916 |
| Genome ID | PPCM01000043 |
| Phylum/Class | [PPCM] marine sediment metagenome; marine sediment |
| Species | |
| Start position on genome | 104741 |
| End posion on genome | 104816 |
| Amino Acid | Val |
| Anticodon | TAC |
| Upstream region at tRNA start position |
aaagaaatat |
| tRNA gene sequence |
GGACGCTTAGCTCAGTTGGGAGAGCATCGCCCTTACAAGGCGAGGGTCACTGGTTCAAGC |
| Downstream region at tRNA end position |
cttcctcacc |
| Secondary structure (Cloverleaf model) | >WENV183746916 Val TAC
t ACCA cttcctcacc
G - C
G - C
A - T
C - G
G - C
C - G
T - A C G
T T G A C C A
T G A A | | | | | A
T C T C G A C T G G C
G | | | | T T
G G A G C
G A A GGGTC
T - A
C - G
G - C
C - G
C - G
C A
T A
T A C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |