Sequence ID | >WENV183746958 |
Genome ID | PPCM01000070 |
Search identical group | |
Phylum/Class | [PPCM] marine sediment metagenome; marine sediment |
Species | |
Start position on genome | 79413 |
End posion on genome | 79506 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
aatcgggata |
tRNA gene sequence |
GGAGAAGTGGCCGAGTTGGCTGAAGGCGCACGCCTGCTAAGCGTGTATGGGGCGTTAAAC |
Downstream region at tRNA end position |
tattttaagg |
Secondary structure (Cloverleaf model) | >WENV183746958 Ser GCT a GCCA tattttaagg G - C G - C A - T G - C A - T A - T G - C T A T C T C T C A T T G A G | | | | | A G G C C G G A G A G C G | | | T T C A G G C T G A G TATGGGGCGTTAAACTCCATC C - G A - T C - G G - C C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |