Sequence ID | >WENV183747564 |
Genome ID | PPCM01005275 |
Search identical group | |
Phylum/Class | [PPCM] marine sediment metagenome; marine sediment |
Species | |
Start position on genome | 1863 |
End posion on genome | 1787 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
tcgatagagc |
tRNA gene sequence |
AGGGGTATAGTTCCAACGGCTAGAACGCCGGTCTCCAAAACCGGATGTTGGGGGTTCGAA |
Downstream region at tRNA end position |
attaagtctt |
Secondary structure (Cloverleaf model) | >WENV183747564 Trp CCA c GCCA attaagtctt A - T G - C G - C G - C G - C T - A A - T T A T C T C C C A A A C A | + | | | G C C T T G G G G G G C G | | | | T T G G A A C C T A G ATGTT C - G C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |