Sequence ID | >WENV183749110 |
Genome ID | PPFU01120814 |
Search identical group | |
Phylum/Class | [PPFU] hypolithon metagenome; Antarctic Hypolithon |
Species | |
Start position on genome | 6669 |
End posion on genome | 6594 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
ccgcgcaggc |
tRNA gene sequence |
GGGCGCTTAGCTCAGTTGGTAGAGCGCTTCCTTTACACGGAAGATGTCGGCGGTTCGAGC |
Downstream region at tRNA end position |
ggtttgcgga |
Secondary structure (Cloverleaf model) | >WENV183749110 Val TAC c ACCA ggtttgcgga G - C G - C G - C C - G G - C C - G T - A C G T C T G C C A T G A A | + | | | G T C T C G G G C G G C G | | | | T T G G A G C T A G ATGTC C - G T - A T - A C - G C - G T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |