| Sequence ID | >WENV183749895 |
| Genome ID | PPFU01227434 |
| Phylum/Class | [PPFU] hypolithon metagenome; Antarctic Hypolithon |
| Species | |
| Start position on genome | 1265 |
| End posion on genome | 1349 |
| Amino Acid | Leu |
| Anticodon | TAG |
| Upstream region at tRNA start position |
aatcggccgc |
| tRNA gene sequence |
GCGAAAGTGGCGGAACTGGCAGACGCGCCGGACTTAGGATCCGGTAGCCGAAAGGCTATG |
| Downstream region at tRNA end position |
gtggcgccac |
| Secondary structure (Cloverleaf model) | >WENV183749895 Leu TAG
c ACtt gtggcgccac
G - C
C - G
G - C
A - T
A - T
A - T
G - C T C
T C C C C C A
C A A G | | | | | G
T G G C G G G G G G C
G | | | T T
G A C G C
C A G G TAGCCGAAAGGCTAT
C - G
C - G
G - C
G - C
A - T
C A
T G
T A G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |