Sequence ID | >WENV183751945 |
Genome ID | PPYE01030265 |
Search identical group | |
Phylum/Class | [PPYE] human gut metagenome; stool from patient with ulcerative colitis |
Species | |
Start position on genome | 7821 |
End posion on genome | 7903 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
gttaacatcT |
tRNA gene sequence |
GCCGCTGTGGCGGAATTGGCAGACGCATACGACTCAAAATCGTACGGGAAACCATATGGG |
Downstream region at tRNA end position |
tttttttagt |
Secondary structure (Cloverleaf model) | >WENV183751945 Leu CAA T ATCa tttttttagt G - C C - G C - G G - C C - G T - A G - C T G T T A C C C A T A A G | | | | | G T G G C G A T G G G C G | | | T T G A C G C C A G A CGGGAAACCAT T - A A - T C - G G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |