Sequence ID | >WENV183752880 |
Genome ID | PPYE01047186 |
Search identical group | |
Phylum/Class | [PPYE] human gut metagenome; stool from patient with ulcerative colitis |
Species | |
Start position on genome | 17943 |
End posion on genome | 17872 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
ttttctacca |
tRNA gene sequence |
GGCTCCATGGTCAAGCGGTTAAGACACCGCCCTTTCACGGCGGTAACAGGGGTTCAAATC |
Downstream region at tRNA end position |
tgtaagattt |
Secondary structure (Cloverleaf model) | >WENV183752880 Glu TTC a Atta tgtaagattt G - C G + T C - G T - A C - G C - G A - T T A T T C C C C A C G A G | | | | | A G A C T G A G G G G C G | | | T T T A G A C T A A TAAC C - G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |