Sequence ID | >WENV183763986 |
Genome ID | PPYE01311476 |
Search identical group | |
Phylum/Class | [PPYE] human gut metagenome; stool from patient with ulcerative colitis |
Species | |
Start position on genome | 21130 |
End posion on genome | 21203 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
catgcggctt |
tRNA gene sequence |
TGGGATATCGTCCAACGGCAGGACATCTGACTCTGGATCAGAGAATTGGGGTTCGAATCC |
Downstream region at tRNA end position |
tttttatgcg |
Secondary structure (Cloverleaf model) | >WENV183763986 Gln CTG t GCCA tttttatgcg T - A G - C G - C G - C A - T T - A A - T T A T G T C C C A A A C + + | | | G C C C T G T G G G G C G | | | | T T G G G A C C A A GAAT T - A C - G T - A G - C A - T C A T G C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |