Sequence ID | >WENV183766074 |
Genome ID | PPYE01345216 |
Search identical group | |
Phylum/Class | [PPYE] human gut metagenome; stool from patient with ulcerative colitis |
Species | |
Start position on genome | 7201 |
End posion on genome | 7127 |
Amino Acid | Ile2 |
Anticodon | CAT |
Upstream region at tRNA start position |
gcgccgtgcg |
tRNA gene sequence |
GGACCCATAGCTCAGTCGGTTAGAGCAGCGGACTCATAATCCGAAGGTCGTGGGATCATG |
Downstream region at tRNA end position |
cgaaggcggg |
Secondary structure (Cloverleaf model) | >WENV183766074 Ile2 CAT g ACga cgaaggcggg G - C G - C A - T C - G C - G C - G A - T C G T C T C C C T T G A A | | | | A C C T C G G T G G G C G | | | | A T G G A G C T T A A AGGTC G A C - G G - C G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |