Sequence ID | >WENV183770269 |
Genome ID | PPYE01433188 |
Search identical group | |
Phylum/Class | [PPYE] human gut metagenome; stool from patient with ulcerative colitis |
Species | |
Start position on genome | 1287 |
End posion on genome | 1213 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
cctctttcac |
tRNA gene sequence |
ACTCGCTTAGTTTATATGGTAAAACATCACCCTTACAAGATGAAGAAAAAGGTTCAAGTC |
Downstream region at tRNA end position |
tgttccagta |
Secondary structure (Cloverleaf model) | >WENV183770269 Val TAC c ACCA tgttccagta A - T C - G T - A C - G G + T C - G T - A T G T T T T C C A A T A A | | | | | A T T T T G A A A G G C G | | | | T T G A A A C T A A AGAA T - A C - G A - T C A C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |