Sequence ID | >WENV183783183 |
Genome ID | PPYF01223543 |
Search identical group | |
Phylum/Class | [PPYF] human gut metagenome; stool from patient with Crohn's disease |
Species | |
Start position on genome | 75 |
End posion on genome | 1 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
ttttgaataT |
tRNA gene sequence |
GGGATCATAGCTCAGCTGGGAGAGCATCTGCCTTACAAGCAGAGGGTCATAGGTTCGAGC |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV183783183 Val TAC T ATnn nnnnnnnnnn G - C G - C G - C A - T T + G C - G A - T C G T T A T C C A C G A A | | | | | G T C T C G A T A G G C G | | | | T T G G A G C G A A GGGTC T - A C - G T - A G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |