Sequence ID | >WENV183786203 |
Genome ID | PPYF01303697 |
Search identical group | |
Phylum/Class | [PPYF] human gut metagenome; stool from patient with Crohn's disease |
Species | |
Start position on genome | 51208 |
End posion on genome | 51284 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
tccacgccat |
tRNA gene sequence |
GCGTCCATAGCTCAGTTGGATAGAGCAACTGCCTTCTAAGCAGTGGGTCACTGGTTCGAA |
Downstream region at tRNA end position |
ttatgaacct |
Secondary structure (Cloverleaf model) | >WENV183786203 Arg TCT t GCCA ttatgaacct G + T C - G G - C T - A C - G C - G A - T T A T T G A C C A T G A A | | | | | G T C T C G A C T G G C G | | | | T T G G A G C A T A A GGGTC A - T C - G T - A G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |