Sequence ID | >WENV183787826 |
Genome ID | PPYF01349286 |
Search identical group | |
Phylum/Class | [PPYF] human gut metagenome; stool from patient with Crohn's disease |
Species | |
Start position on genome | 175045 |
End posion on genome | 175120 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
gcctaacatg |
tRNA gene sequence |
GTGACTATAGTTCAGTCGGTTAGAGCGTCAGATTGTGGTTCTGAATGTCGTGGGTTCGAA |
Downstream region at tRNA end position |
tcacctatga |
Secondary structure (Cloverleaf model) | >WENV183787826 His GTG g CCCt tcacctatga G - C T - A G - C A - T C - G T - A A - T T A T C A C C C A T G A A | | | | | G C C T T G G T G G G C G | | + | T T G G A G C T T A G ATGTC T - A C - G A - T G - C A - T T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |