Sequence ID | >WENV183790597 |
Genome ID | PPYF01412527 |
Search identical group | |
Phylum/Class | [PPYF] human gut metagenome; stool from patient with Crohn's disease |
Species | |
Start position on genome | 1666 |
End posion on genome | 1593 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
tggaggttgc |
tRNA gene sequence |
GGCCCCATCGTATAGCGGCCTAGTACTCCGCCCTCTCACGGCGGCAACACCGGTTCAAAT |
Downstream region at tRNA end position |
taggaaaaaa |
Secondary structure (Cloverleaf model) | >WENV183790597 Glu CTC c ACac taggaaaaaa G - C G + T C - G C - G C - G C - G A - T T A T T G G C C A C G A C | | | | | A G T A T G A C C G G C G + | | | T T C G T A C C T A T CAAC C - G C - G G - C C - G C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |