Sequence ID | >WENV183802837 |
Genome ID | PVBE010791674 |
Search identical group | |
Phylum/Class | [PVBE] marine metagenome; water |
Species | |
Start position on genome | 441 |
End posion on genome | 358 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
atagtctgtt |
tRNA gene sequence |
GGGGAGATGGCCGAGCGGTCAATGGCAGCAGACTGTAAATCTGCCGGCGTACGCCTACGG |
Downstream region at tRNA end position |
taatgcgggt |
Secondary structure (Cloverleaf model) | >WENV183802837 Tyr GTA t ACaa taatgcgggt G - C G - C G - C G - C A - T G - C A - T T A T C T T C C A C G A G | + | | | G G G C C G G G A G G C G + | | | T T T T G G C C A A A CGGCGTACGCCTAC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |