Sequence ID | >WENV170000947 |
Genome ID | AGBJ01000003 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 32197 |
End posion on genome | 32123 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
gttaaattct |
tRNA gene sequence |
GCCACCATAGCTCAGGGGTAGAGCAGGGGTTTTGTAAACCTCTGGTCGGGGGTTCGAATC |
Downstream region at tRNA end position |
taagtgtaaa |
Secondary structure (Cloverleaf model) | >WENV170000947 Thr TGT t TCCA taagtgtaaa G - C C - G C - G A - T C - G C - G A - T T A T C T C C C A G A A | + | | | G G C T C G G G G G G C G | | | | T T G G A G C T A A TGGTC G - C G + T G - C G - C T - A T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |