Sequence ID | >WENV170000949 |
Genome ID | AGBJ01000003 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 31991 |
End posion on genome | 31915 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
ccatttttta |
tRNA gene sequence |
GCGGGAATAGCTCAGTTGGCTAGAGCATTAGCCTTCCAAGCTAAGGGTCGCGGGTTCGAG |
Downstream region at tRNA end position |
ggctcatgta |
Secondary structure (Cloverleaf model) | >WENV170000949 Gly TCC a TCCA ggctcatgta G - C C - G G - C G - C G - C A - T A - T C G T T G C C C A T G A A + | | | | G T C T C G G C G G G C G | | | | T T G G A G C C T A A GGGTC T - A T - A A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |