Sequence ID | >WENV170000951 |
Genome ID | AGBJ01000003 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 30455 |
End posion on genome | 30380 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
attgttgcgt |
tRNA gene sequence |
AGGCTCGTAGCTTAATTGGCAAAGCGGCGGTCTCCAAAACCGAAGAGTGCGGGTTCAATT |
Downstream region at tRNA end position |
ttcttttatt |
Secondary structure (Cloverleaf model) | >WENV170000951 Trp CCA t GCCA ttcttttatt A - T G - C G - C C - G T + G C - G G - C T T T C G T C C A T A A A | | + | | A T T T C G G C G G G C G | | | | T T G A A G C C A G AGAGT G A C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |