Sequence ID | >WENV170000952 |
Genome ID | AGBJ01000008 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 182 |
End posion on genome | 108 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
agttgctgat |
tRNA gene sequence |
GGCCCCATCGTCTAGCGGTTAGGATCCATGGTTTTCATCCATGTTACAGGAGTTCAAGTC |
Downstream region at tRNA end position |
ttttataact |
Secondary structure (Cloverleaf model) | >WENV170000952 Glu TTC t ACCA ttttataact G - C G + T C - G C - G C - G C - G A - T T G T T C C T C A C G A C | | | | | A G T C T G A G G A G C G + | | + T T T G G A T T A C TTAC C - G A - T T - A G - C G - C T T T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |