Sequence ID | >WENV170000954 |
Genome ID | AGBJ01000018 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 13927 |
End posion on genome | 13851 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
taatgatggt |
tRNA gene sequence |
GCTGGCGTAGCTCAGTTGGCTAGAGCAGCTGATTTGTAATCAGCAGGTCGGGGGTTCGAG |
Downstream region at tRNA end position |
taaaatataa |
Secondary structure (Cloverleaf model) | >WENV170000954 Thr TGT t TCCA taaaatataa G - C C - G T - A G - C G - C C - G G + T T G T T T C C C A T G A A + + | | | G T C T C G G G G G G C G | | | | T T G G A G C C T A A AGGTC G - C C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |