Sequence ID | >WENV170000955 |
Genome ID | AGBJ01000018 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 13804 |
End posion on genome | 13720 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
taaacattaa |
tRNA gene sequence |
GGTGAGTTACTCAAGCGGCCAACGAGGGCAGACTGTAAATCTGCTGACTATGTCTTCGAA |
Downstream region at tRNA end position |
tatgttaaat |
Secondary structure (Cloverleaf model) | >WENV170000955 Tyr GTA a ACCA tatgttaaat G - C G - C T - A G - C A - T G - C T - A T A T C T T C C A C G A A | | | | | G G A C T C G A A G G C G | | | T T C C G A G C A A G TGACTATGTCTTC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |