Sequence ID | >WENV170000957 |
Genome ID | AGBJ01000018 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 13462 |
End posion on genome | 13388 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
caatcgagtt |
tRNA gene sequence |
GCCCATATGGCTCAGGGGTAGAGCACTTCCTTGGTAAGGAAGAGGTCGTGAGTTCAAGTC |
Downstream region at tRNA end position |
ctctccatga |
Secondary structure (Cloverleaf model) | >WENV170000957 Thr GGT t TCCA ctctccatga G - C C - G C - G C - G A - T T - A A - T T G T C A C T C A G A G | | | | | A G C T C G G T G A G C G | | | | T T G G A G C T A A AGGTC C - G T - A T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |