Sequence ID | >WENV170000958 |
Genome ID | AGBJ01000018 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 11800 |
End posion on genome | 11725 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
tattatttct |
tRNA gene sequence |
AGGCCAATAGCTCAGTTGGTAGAGCACTGGTCTCCAAAACCAGGTGCCGTGGGTTCGAGT |
Downstream region at tRNA end position |
caataaaagg |
Secondary structure (Cloverleaf model) | >WENV170000958 Trp CCA t GCCA caataaaagg A - T G - C G - C C - G C - G A - T A - T T G T C T C C C A T G A A | | | | G T C T C G G T G G G C G | | | | T T G G A G C T A A GTGCC C - G T - A G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |