Sequence ID | >WENV170000959 |
Genome ID | AGBJ01000025 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 13863 |
End posion on genome | 13787 |
Amino Acid | Arg |
Anticodon | GCG |
Upstream region at tRNA start position |
tgttatatgt |
tRNA gene sequence |
GCACTCATAGCTCAGCTGGATAGAGCATCGGTTTGCGGTACCGAAGGTCTCAGGTTCGAA |
Downstream region at tRNA end position |
cttcttctta |
Secondary structure (Cloverleaf model) | >WENV170000959 Arg GCG t ACCA cttcttctta G + T C - G A - T C - G T + G C - G A - T T A T A G T C C A C G A A | | | | | G T C T C G T C A G G C G | | | | T T G G A G C A T A A AGGTC T - A C - G G - C G - C T - A T T T G G C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |