Sequence ID | >WENV170000960 |
Genome ID | AGBJ01000037 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 11124 |
End posion on genome | 11199 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
atttcataat |
tRNA gene sequence |
GTCCTCATCGCTTAACTGGATAAAGCAGGGCCCTCCTAAGGCCTAGCTCGAGGTTCGAGT |
Downstream region at tRNA end position |
cctatcatct |
Secondary structure (Cloverleaf model) | >WENV170000960 Arg CCT t ACCA cctatcatct G + T T - A C - G C - G T + G C - G A - T T G T G C T C C A C A A C | | | | | G T T T C G C G A G G C G | | | | T T G A A G C A T A A AGCT G + T G - C G - C C - G C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |