Sequence ID | >WENV170000961 |
Genome ID | AGBJ01000040 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 6240 |
End posion on genome | 6153 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
ataaaagtat |
tRNA gene sequence |
AGAGAGGTGGCCGAGTGGTCGAAGGCGCACGACTGGAACTCGTGTATGGGGCAACTCATC |
Downstream region at tRNA end position |
taccccatga |
Secondary structure (Cloverleaf model) | >WENV170000961 Ser GGA t GCCA taccccatga A - T G - C A - T G - C A - T G - C G - C T A T T T C C C A T G A G + | | | | G G G C C G G A G G G C G | | | T T T A G G C C G A G TATGGGGCAACTCATC C - G A - T C - G G - C A - T C C T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |