Sequence ID | >WENV170000963 |
Genome ID | AGBJ01000061 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 4870 |
End posion on genome | 4946 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
aataagttgc |
tRNA gene sequence |
GCGCCCGTAGTTCAACTGGATAGAGCACCAGATTTCGGCTCTGGTAGTTGGGGGTTCAAA |
Downstream region at tRNA end position |
attttaggaa |
Secondary structure (Cloverleaf model) | >WENV170000963 Arg TCG c ACCA attttaggaa G + T C - G G - C C - G C - G C - G G - C T A T C C T C C A C A A A | | + | | A T C T T G G G G G G C G | | + | T T G G A G C A T A A TAGTT C - G C - G A - T G - C A - T T C T G T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |