Sequence ID | >WENV170000964 |
Genome ID | AGBJ01000065 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 8573 |
End posion on genome | 8647 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
tcagaaaaat |
tRNA gene sequence |
GGCCCCATCGTTTAGTGGTTAGGACGCAGGATTCTCATTCCTGTAACAGGGGTTCGATTC |
Downstream region at tRNA end position |
gttttaaaat |
Secondary structure (Cloverleaf model) | >WENV170000964 Glu CTC t ACCA gttttaaaat G + T G - C C - G C - G C - G C - G A - T T T T T C C C C A T G A C | | | | | G G T T T G A G G G G C G + + | | T T T G G A C T A G TAAC C - G A - T G - C G - C A - T T T T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |