Sequence ID | >WENV170000967 |
Genome ID | AGBJ01000070 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 4740 |
End posion on genome | 4816 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
caacaaatgt |
tRNA gene sequence |
CGCGGAATAGAGCAGTTTGGTAGCTCGTTGGGCTCATAACCCAAAGGTCACAGGTTCAAA |
Downstream region at tRNA end position |
acaaaaaata |
Secondary structure (Cloverleaf model) | >WENV170000967 Met CAT t ACCA acaaaaaata C A G - C C - G G - C G - C A - T A - T T A T T G T C C A T G A A | | | | | A T C G A G A C A G G C T | | | | T T G G C T C G T A G AGGTC T - A T - A G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |