Sequence ID | >WENV170000968 |
Genome ID | AGBJ01000075 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 5334 |
End posion on genome | 5248 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
attattatgc |
tRNA gene sequence |
GCGAGAGTGGCGGAATTGGCAGACGCGCTGGACTTAGAATCCAGTTGGAGAAATCCTGTA |
Downstream region at tRNA end position |
atttttttta |
Secondary structure (Cloverleaf model) | >WENV170000968 Leu TAG c ACCA atttttttta G - C C - G G - C A - T G - C A C G - C T G T T C C C C A T A A G | | | | | G T G G C G A G G G G C G | | | T T G A C G C C A G G TTGGAGAAATCCTGT C - G T - A G - C G - C A - T C A T A T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |