Sequence ID | >WENV170000969 |
Genome ID | AGBJ01000088 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 473 |
End posion on genome | 559 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
catatcaatt |
tRNA gene sequence |
GCTGAAGTGGCGGAATTGGCAGACGCGCCAGGTTCAGGGTCTGGTGGGAGTTATCCTGTA |
Downstream region at tRNA end position |
tttatcttgc |
Secondary structure (Cloverleaf model) | >WENV170000969 Leu CAG t ACCA tttatcttgc G - C C - G T - A G - C A - T A - T G - C T A T T C C C C A T A A G | | | | | G T G G C G A G G G G C G | | | T T G A C G C C A G G TGGGAGTTATCCTGT C - G C - G A - T G - C G + T T G T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |