Sequence ID | >WENV170000972 |
Genome ID | AGBJ01000102 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 6770 |
End posion on genome | 6694 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
attctttgtt |
tRNA gene sequence |
GGGTGATTAGCTCAGCAGGTTAGAGCACTACGTTCACATCGTAGGGGTCACTGGTTCGAA |
Downstream region at tRNA end position |
ttttgatagc |
Secondary structure (Cloverleaf model) | >WENV170000972 Val CAC t ACCA ttttgatagc G - C G - C G - C T - A G - C A - T T - A T A T T G A C C A C G A A | | | | | G A C T C G A C T G G C G | | | | T T G G A G C T T A A GGGTC C - G T - A A - T C - G G - C T T T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |