Sequence ID | >WENV170000975 |
Genome ID | AGBJ01000114 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 8661 |
End posion on genome | 8736 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
agttttttat |
tRNA gene sequence |
GACCTTTTAGCTCAGTTGGTAGAGCAACTCCCTTTTAAGGAGTGGGCCCATGGTTCGAAT |
Downstream region at tRNA end position |
ctatagatat |
Secondary structure (Cloverleaf model) | >WENV170000975 Lys TTT t ACCA ctatagatat G - C A - T C - G C - G T + G T - A T - A T A T G T A C C A T G A A | | | | | G T C T C G C A T G G C G | | | | T T G G A G C T A A GGGCC A - T C - G T - A C - G C - G C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |