Sequence ID | >WENV170000977 |
Genome ID | AGBJ01000114 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 8856 |
End posion on genome | 8931 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
ggttcttgat |
tRNA gene sequence |
GACCCTTTCATCTAGTGGCCAAGGATATTACGTTTTCAACGTAAAAACAGAGGTTCAAAT |
Downstream region at tRNA end position |
atcttgtcct |
Secondary structure (Cloverleaf model) | >WENV170000977 Glu TTC t GCCA atcttgtcct G - C A - T C - G C - G C - G T - A T - A T A T T T T C C A T G A C | + | | | A G T C T A A G A G G C G + | | | T T C G G A T C A A A AAAC T - A T - A A - T C - G G - C T A T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |