Sequence ID | >WENV170000978 |
Genome ID | AGBJ01000114 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 8956 |
End posion on genome | 9031 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
acatacataa |
tRNA gene sequence |
GGTCGCTTAGCTCAGTTGGTAGAGCGCTACCCTTACAAGGTAGATGTCACAAGTTCGAGT |
Downstream region at tRNA end position |
tatgtacatt |
Secondary structure (Cloverleaf model) | >WENV170000978 Val TAC a ACCA tatgtacatt G - C G - C T - A C - G G - C C - G T - A T G T T G T T C A T G A A | | | | | G T C T C G A C A A G C G | | | | T T G G A G C T A G ATGTC C - G T - A A - T C - G C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |