Sequence ID | >WENV170000979 |
Genome ID | AGBJ01000114 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 9088 |
End posion on genome | 9164 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
tggtttaggt |
tRNA gene sequence |
GCGGTGGTAGTTCAGTTGGTTAGAATACCTGCCTGTCACGCAGGGGGTCGCGAGTTCGAG |
Downstream region at tRNA end position |
ttacacttca |
Secondary structure (Cloverleaf model) | >WENV170000979 Asp GTC t GCCA ttacacttca G - C C - G G - C G - C T - A G - C G - C T G T T G C T C A T G A A + | | | | G T C T T G G C G A G C G | | | + T T G G A A T T T A A GGGTC C - G C - G T - A G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |