Sequence ID | >WENV170000982 |
Genome ID | AGBJ01000117 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 8971 |
End posion on genome | 9046 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
acccaaatat |
tRNA gene sequence |
GGAACCATCGCCAAGTTGGTAAGGCCGCAGCCTGCAAAGCTGCTATTCGCCGGTTCGAGT |
Downstream region at tRNA end position |
ttatataaac |
Secondary structure (Cloverleaf model) | >WENV170000982 Cys GCA t TCCA ttatataaac G - C G - C A - T A - T C - G C - G A - T T G T C G G C C A T G A C | | | | | G T A C C G G C C G G C G | | | T T G A G G C T A C TATTC G - C C - G A - T G - C C - G C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |