Sequence ID | >WENV170000983 |
Genome ID | AGBJ01000117 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 9101 |
End posion on genome | 9188 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
tacaaaacgt |
tRNA gene sequence |
CGGGAGATGTCAGAGTGGTCGAATGTGCCGGTCTTGAAAACCGGTGAGGGTCATACCTCC |
Downstream region at tRNA end position |
ctaattttac |
Secondary structure (Cloverleaf model) | >WENV170000983 Ser TGA t GCCA ctaattttac C - G G - C G - C G - C A - T G - C A - T T A T C C C C C A T G A G | | | | | G G G A C T G G G G G C G | | T T T A T G T C G A G TGAGGGTCATACCTCC C - G C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |