Sequence ID | >WENV170000987 |
Genome ID | AGBJ01000135 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 2967 |
End posion on genome | 2892 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
acgcactgat |
tRNA gene sequence |
GCGGGCGTAGCTCAGTGGCTAGAGTTCCTGCCTTCCAAGCAGGCTGTCGAGGGTTCGAAT |
Downstream region at tRNA end position |
cacacgttga |
Secondary structure (Cloverleaf model) | >WENV170000987 Gly TCC t TCCA cacacgttga G - C C - G G - C G - C G - C C - G G - C T A T T T C C C A T G A A + | | | | G G C T C G G A G G G C G | | | + T T C G A G T T A T CTGTC C - G C - G T - A G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |