Sequence ID | >WENV170000988 |
Genome ID | AGBJ01000143 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 6221 |
End posion on genome | 6298 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
attgcatttt |
tRNA gene sequence |
CGGGGTGTGGCGCAGCCCGGTCAGCGCACCTGCTTTGGGAGCAGGGGGTCCCGAGTTCAA |
Downstream region at tRNA end position |
gtttctctgc |
Secondary structure (Cloverleaf model) | >WENV170000988 Pro TGG t ACCA gtttctctgc C - G G - C G - C G - C G - C T - A G - C T A T G G C T C A C C G A G | | | | | A C C G C G C C G A G C G | | | | T T G G C G C T C A A GGGTC C - G C - G T - A G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |