Sequence ID | >WENV170000989 |
Genome ID | AGBJ01000161 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 3147 |
End posion on genome | 3223 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
aacttaatgt |
tRNA gene sequence |
GGGTGGTTAGCTCAGTTGGTTAGAGTACTACGTTGACATCGTAGGGGTCACCGGTTCGAA |
Downstream region at tRNA end position |
ttttttatta |
Secondary structure (Cloverleaf model) | >WENV170000989 Val GAC t ACCA ttttttatta G - C G - C G - C T - A G - C G - C T - A T A T T G A C C A T G A A | | | | G T C T C G A C C G G C G | | | + T T G G A G T T T A A GGGTC C - G T - A A - T C - G G - C T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |