Sequence ID | >WENV170000990 |
Genome ID | AGBJ01000212 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 4413 |
End posion on genome | 4337 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
tatggtttgc |
tRNA gene sequence |
GGGGGTGTAGTTCAGTTGGTTAGAACGTCTGCCTGTCACGCAGAAGGTCGCGAGTTCGAG |
Downstream region at tRNA end position |
ttttttatac |
Secondary structure (Cloverleaf model) | >WENV170000990 Asp GTC c GCCA ttttttatac G - C G - C G - C G + T G - C T - A G - C T G T T G C C C A T G A A + | | | G T C T T G G C G A G C G | | | | T T G G A A C T T A G AGGTC T - A C - G T - A G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |