Sequence ID | >WENV170000992 |
Genome ID | AGBJ01000228 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 93 |
End posion on genome | 3 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
caaaacatat |
tRNA gene sequence |
GGACAGTTGGGTGAGTTGGCTGAAACCACATCCCTGCTAAGGATGCGTACTGGTAACGGT |
Downstream region at tRNA end position |
ctnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170000992 Ser GCT t GCCA ctnnnnnnnn G - C G - C A - T C - G A - T G - C T - A T A T C T C C C A T T G A G | | | | | G G G T G G G A G G G C G | | | T T C A A C C T G A A CGTACTGGTAACGGTACC C - G A - T T - A C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |