Sequence ID | >WENV170000993 |
Genome ID | AGBJ01000248 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 5262 |
End posion on genome | 5336 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
attttttttc |
tRNA gene sequence |
GGGGAAGTAGCTCAGTGGGAGAGCACAGCGTTCGCAACGCTGGGGTCGAGGGTTCGAGTC |
Downstream region at tRNA end position |
gtcttcgttt |
Secondary structure (Cloverleaf model) | >WENV170000993 Ala CGC c ACCA gtcttcgttt G - C G - C G + T G - C A - T A - T G - C T G T T T C C C A G A A + | | | | G T C T C G G A G G G C G | | | | T T G G A G C G A A GGGTC C - G A - T G - C C - G G - C T A T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |