Sequence ID | >WENV170000994 |
Genome ID | AGBJ01000251 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 550 |
End posion on genome | 462 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
tgaaaaaaat |
tRNA gene sequence |
GCCGAAGTGGCGAAATTGGCAGACGCACTGGATTCAAAATCCAGCGCCGTTTATGCGGTA |
Downstream region at tRNA end position |
taaattttaa |
Secondary structure (Cloverleaf model) | >WENV170000994 Leu CAA t ACCA taaattttaa G - C C - G C - G G - C A - T A - T G - C T G T C A G C C A T A A G | | | | | G T A G C G G T C G G C G | | | T T G A C G C C A G A CGCCGTTTATGCGGTAT C - G T - A G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |