Sequence ID | >WENV170000995 |
Genome ID | AGBJ01000257 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 1829 |
End posion on genome | 1743 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
atttacccgt |
tRNA gene sequence |
GCTGAAGTGGCGGAATTGGCAGACGCGCTAGGTTCAGGACTTAGTCCCGAAACCGGGTTA |
Downstream region at tRNA end position |
tttttcagga |
Secondary structure (Cloverleaf model) | >WENV170000995 Leu CAG t ACCA tttttcagga G - C C - G T - A G - C A - T A - T G - C T G T T C C C C A T A A G | | | | | G T G G C G A G G G G C G | | | T T G A C G C C A G G TCCCGAAACCGGGTT C - G T - A A - T G + T G - C T A T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |