Sequence ID | >WENV170000997 |
Genome ID | AGBJ01000259 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 5236 |
End posion on genome | 5310 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
attttttttc |
tRNA gene sequence |
TGGGTCGTAGCCAAGGGGCAAGGCACAGGGTTTTGGTCCCTGCATTCGTAGGTTCGAATC |
Downstream region at tRNA end position |
tttttaattt |
Secondary structure (Cloverleaf model) | >WENV170000997 Gln TTG c GCCA tttttaattt T - A G - C G - C G - C T - A C - G G - C T A T C A T C C A G A A | | | | | G G A C C G G T A G G C G | | | T T G A G G C C A A CATTC C - G A - T G - C G - C G - C T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |