Sequence ID | >WENV170000998 |
Genome ID | AGBJ01000266 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 2723 |
End posion on genome | 2798 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
attttcaggt |
tRNA gene sequence |
GCACCTATAGCTCAATCGGTAGAGCAACTGACTCTTAATCAGTAGGTTCTGGGTTCAAGT |
Downstream region at tRNA end position |
ttttttatca |
Secondary structure (Cloverleaf model) | >WENV170000998 Lys CTT t ACCA ttttttatca G + T C - G A - T C - G C - G T - A A - T T G T G T C C C A T A A A | | | | A C C T C G C T G G G C G | | | | T T G G A G C T A A AGGTT A - T C - G T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |