Sequence ID | >WENV170001005 |
Genome ID | AGBJ01000353 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 4284 |
End posion on genome | 4368 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
atgtacctat |
tRNA gene sequence |
GCCGCAGTGATGGAACTGGTAGACTTGGTAGACTCAAAATCTTCTGCCTTCGGGCGTGTC |
Downstream region at tRNA end position |
cccnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170001005 Leu CAA t ACCA cccnnnnnnn G + T C - G C - G G - C C - G A - T G - C T A T C A G C C A C A A G | | | | | G T G G T A G T C G G C G | | T T G A C T T T A G G TGCCTTCGGGCGT G - C T T A - T G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |